Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3337629
End position: 3337655
Length: 27

DNA sequence
>NC_011365, from 3337629 to 3337655 (27 bp); Gluconacetobacter diazotrophicus PAl 5 ATGCCGGCCATGCCGGCGATCCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3337569-3338123	Sequence	Gdia_3048 - hypothetical protein (Protein is coded in complementary strand; from 3338123 to 3337569)