Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3200813
End position: 3200842
Length: 30

DNA sequence
>NC_011365, from 3200813 to 3200842 (30 bp); Gluconacetobacter diazotrophicus PAl 5 GGCGCGCGCGGGATCGCGCGAGCGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3199954-3201300	Sequence	Gdia_2920 - major facilitator superfamily protein