Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 3135261
End position: 3135305
Length: 45

DNA sequence
>NC_011365, from 3135261 to 3135305 (45 bp); Gluconacetobacter diazotrophicus PAl 5 CAGGGCGGCCGGCAGCAGGACGGTCCGCAGCAGGGCGGCCCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3134938-3135336	Sequence	Gdia_2867 - hypothetical protein (Protein is coded in complementary strand; from 3135336 to 3134938)