Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 301847
End position: 301873
Length: 27

DNA sequence
>NC_011365, from 301847 to 301873 (27 bp); Gluconacetobacter diazotrophicus PAl 5 CCATGTCGCCCATGCCGCCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 301840-303483	Sequence	Gdia_0271 groEL chaperonin GroEL (Protein is coded in complementary strand; from 303483 to 301840)