Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2937739
End position: 2937762
Length: 24

DNA sequence
>NC_011365, from 2937739 to 2937762 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCAGCAGCCGCAGCAGCCGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2936010-2938745	Sequence	Gdia_2666 - mechanosensitive ion channel protein MscS (Protein is coded in complementary strand; from 2938745 to 2936010)