Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 292332
End position: 292367
Length: 36

DNA sequence
>NC_011365, from 292332 to 292367 (36 bp); Gluconacetobacter diazotrophicus PAl 5 CCCATGGAACGCCCGCTGGAACGCCCGCTGGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 292336-293076	Sequence	Gdia_0264 - silent information regulator protein Sir2