Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2871709
End position: 2871733
Length: 25

DNA sequence
>NC_011365, from 2871709 to 2871733 (25 bp); Gluconacetobacter diazotrophicus PAl 5 CGGTGCGGTCCGGGGCGGCGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2870755-2871759	Sequence	Gdia_2606 - monosaccharide-transporting ATPase