Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2824863
End position: 2824889
Length: 27

DNA sequence
>NC_011365, from 2824863 to 2824889 (27 bp); Gluconacetobacter diazotrophicus PAl 5 GGCCGGAGCGGCCGGCGCGGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2824858-2825607	Sequence	Gdia_2572 - hypothetical protein (Protein is coded in complementary strand; from 2825607 to 2824858)