Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 254874
End position: 254897
Length: 24

DNA sequence
>NC_011365, from 254874 to 254897 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CAGCGCCAGCCCCAGCACCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 254677-256173	Sequence	Gdia_0232 - Ppx/GppA phosphatase (Protein is coded in complementary strand; from 256173 to 254677)