Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2450766
End position: 2450789
Length: 24

DNA sequence
>NC_011365, from 2450766 to 2450789 (24 bp); Gluconacetobacter diazotrophicus PAl 5 ACCACGACCAGGACCAGGACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2448750-2451845	Sequence	Gdia_2209 - CzcA family heavy metal efflux pump (Protein is coded in complementary strand; from 2451845 to 2448750)