Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2384067
End position: 2384090
Length: 24

DNA sequence
>NC_011365, from 2384067 to 2384090 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CGCCGCAGCCGCCGTCGCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2383573-2384298	Sequence	Gdia_2154 - hypothetical protein (Protein is coded in complementary strand; from 2384298 to 2383573)