Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2356200
End position: 2356229
Length: 30

DNA sequence
>NC_011365, from 2356200 to 2356229 (30 bp); Gluconacetobacter diazotrophicus PAl 5 CCGTCGCCGTCGCGGTCGCCGTAGCGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2355279-2357477	Sequence	Gdia_2125 - amylo-alpha-16-glucosidase (Protein is coded in complementary strand; from 2357477 to 2355279)