Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2266702
End position: 2266725
Length: 24

DNA sequence
>NC_011365, from 2266702 to 2266725 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCGCCGGCCCCGGCGGCGGCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2266562-2267263	Sequence	Gdia_2045 - Sel1 domain-containing protein repeat-containing protein