Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2241776
End position: 2241800
Length: 25

DNA sequence
>NC_011365, from 2241776 to 2241800 (25 bp); Gluconacetobacter diazotrophicus PAl 5 GTGCGGTTCGGTGGGGTTCGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2241043-2242293	Sequence	Gdia_2019 - major facilitator superfamily transporter