Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2198305
End position: 2198334
Length: 30

DNA sequence
>NC_011365, from 2198305 to 2198334 (30 bp); Gluconacetobacter diazotrophicus PAl 5 CGCCGGCAGGGGCCGGAAGGCGCCGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2198010-2198306	Sequence	Gdia_1979 - coenzyme PQQ synthesis D (Protein is coded in complementary strand; from 2198306 to 2198010)
ORF. 2198303-2199052	Sequence	Gdia_1980 - pyrroloquinoline quinone biosynthesis protein PqqC (Protein is coded in complementary strand; from 2199052 to 2198303)