Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2178769
End position: 2178793
Length: 25

DNA sequence
>NC_011365, from 2178769 to 2178793 (25 bp); Gluconacetobacter diazotrophicus PAl 5 CCGGCGCGGCCCCGCCCAGCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2178753-2179655	Sequence	Gdia_1964 - acetyl-CoA carboxylase, carboxyl transferase subunit beta (Protein is coded in complementary strand; from 2179655 to 2178753)