Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 2051516
End position: 2051539
Length: 24

DNA sequence
>NC_011365, from 2051516 to 2051539 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CACCACCCCCACCACCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2049240-2052563	Sequence	Gdia_1842 - acriflavin resistance protein (Protein is coded in complementary strand; from 2052563 to 2049240)