Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1804911
End position: 1804955
Length: 45

DNA sequence
>NC_011365, from 1804911 to 1804955 (45 bp); Gluconacetobacter diazotrophicus PAl 5 CAAGAAGACCGTTGCCAAGAAGGTCGGTGCCAAGAAGACGGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1804829-1805356	Sequence	Gdia_1624 - phosphoribosyl-ATP diphosphatase