Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1753157
End position: 1753192
Length: 36

DNA sequence
>NC_011365, from 1753157 to 1753192 (36 bp); Gluconacetobacter diazotrophicus PAl 5 CGAGGACTGGGGCGAAGACTGGGACGAAGACCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1752954-1754699	Sequence	Gdia_1577 - Fis family transcriptional regulator NifA (Protein is coded in complementary strand; from 1754699 to 1752954)