Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1676123
End position: 1676152
Length: 30

DNA sequence
>NC_011365, from 1676123 to 1676152 (30 bp); Gluconacetobacter diazotrophicus PAl 5 CCCGCCCCGCCCGGCGCCGCACCGCCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1676091-1677239	Sequence	Gdia_1499 - lysine 2,3-aminomutase YodO family protein