Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1674622
End position: 1674648
Length: 27

DNA sequence
>NC_011365, from 1674622 to 1674648 (27 bp); Gluconacetobacter diazotrophicus PAl 5 CCCCAGCCGCCCCAGCCGCCCCAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1674490-1674924	Sequence	Gdia_1497 - hypothetical protein (Protein is coded in complementary strand; from 1674924 to 1674490)