Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1587361
End position: 1587387
Length: 27

DNA sequence
>NC_011365, from 1587361 to 1587387 (27 bp); Gluconacetobacter diazotrophicus PAl 5 CCCCGGCTGCCCCGGTTGGCCCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1586858-1587988	Sequence	Gdia_1425 - putative L-sorbosone dehydrogenase (Protein is coded in complementary strand; from 1587988 to 1586858)