Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1490008
End position: 1490031
Length: 24

DNA sequence
>NC_011365, from 1490008 to 1490031 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCCTGGGCCTGGGCCAGGGGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1488715-1490133	Sequence	Gdia_1332 - hypothetical protein (Protein is coded in complementary strand; from 1490133 to 1488715)