Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1479402
End position: 1479425
Length: 24

DNA sequence
>NC_011365, from 1479402 to 1479425 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GCCGCTGGCGCTGCTGCTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1479227-1480486	Sequence	Gdia_1325 - major facilitator superfamily protein