Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1421100
End position: 1421123
Length: 24

DNA sequence
>NC_011365, from 1421100 to 1421123 (24 bp); Gluconacetobacter diazotrophicus PAl 5 CGGCGGCGCCGGCGGGGGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1420948-1421730	Sequence	Gdia_1277 - PRC-barrel domain-containing protein (Protein is coded in complementary strand; from 1421730 to 1420948)