Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1351717
End position: 1351761
Length: 45

DNA sequence
>NC_011365, from 1351717 to 1351761 (45 bp); Gluconacetobacter diazotrophicus PAl 5 GGCGGCGGCGGCATGGGCGGCGGCGGAGGGGGCGGCGGCGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1351057-1352049	Sequence	Gdia_1212 - hypothetical protein (Protein is coded in complementary strand; from 1352049 to 1351057)