Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1235120
End position: 1235155
Length: 36

DNA sequence
>NC_011365, from 1235120 to 1235155 (36 bp); Gluconacetobacter diazotrophicus PAl 5 CCGGTTTCATGGCTGGTTTCATAGCCGGATTCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1233844-1236618	Sequence	Gdia_1100 - group 1 glycosyl transferase (Protein is coded in complementary strand; from 1236618 to 1233844)