Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 1225049
End position: 1225078
Length: 30

DNA sequence
>NC_011365, from 1225049 to 1225078 (30 bp); Gluconacetobacter diazotrophicus PAl 5 GCCGTGACGCGCCGTGCCGACCCGCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1224320-1225300	Sequence	Gdia_1089 - ribose-phosphate pyrophosphokinase (Protein is coded in complementary strand; from 1225300 to 1224320)