Sequence retrieval

Genome: Gluconacetobacter diazotrophicus PAl 5
Start position: 113546
End position: 113569
Length: 24

DNA sequence
>NC_011365, from 113546 to 113569 (24 bp); Gluconacetobacter diazotrophicus PAl 5 GTCGGCGTGGGCGACGGCATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 113229-113756	Sequence	Gdia_0100 - cytochrome c class I (Protein is coded in complementary strand; from 113756 to 113229)