Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 533268
End position: 533294
Length: 27

DNA sequence
>NC_011294, from 533268 to 533294 (27 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 GCGAATATGGCGAATATGGCGAATATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 533124-534785	Sequence	SEN0475 ushA bifunctional UDP-sugar hydrolase/5'-nucleotidase