Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 3891075
End position: 3891101
Length: 27

DNA sequence
>NC_011294, from 3891075 to 3891101 (27 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 GCAGCGCCAGCAGCACCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3890975-3891187	Sequence	SEN3632 ccmD heme exporter protein D (Protein is coded in complementary strand; from 3891187 to 3890975)