Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 3352242
End position: 3352265
Length: 24

DNA sequence
>NC_011294, from 3352242 to 3352265 (24 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 TCGCTTTCGCTTTCTCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3351968-3353140	Sequence	SEN3134 obgE GTPase ObgE (Protein is coded in complementary strand; from 3353140 to 3351968)