Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 2570420
End position: 2570449
Length: 30

DNA sequence
>NC_011294, from 2570420 to 2570449 (30 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 ACGCCGTCGCACGCCGCCTCACGCAGTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2569562-2570749	Sequence	SEN2441 eutG alchohol dehydrogenase (Protein is coded in complementary strand; from 2570749 to 2569562)