Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 2345586
End position: 2345612
Length: 27

DNA sequence
>NC_011294, from 2345586 to 2345612 (27 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 GCAGCGCCAGCAGCACCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2345486-2345698	Sequence	SEN2234 - heme exporter protein D2 (Protein is coded in complementary strand; from 2345698 to 2345486)