Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 199490
End position: 199534
Length: 45

DNA sequence
>NC_011294, from 199490 to 199534 (45 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 GGCGAGATGGATCATGGCAACATGGATCACAGCGGGATGAATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 198306-199916	Sequence	SEN0173 cueO multicopper oxidase