Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 4211680
End position: 4211709
Length: 30

DNA sequence
>NC_011294, from 4211680 to 4211709 (30 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 CGCGGTAAATCTCGATAAATGGCGGTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4210569-4211720	Sequence	SEN3915 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4211720 to 4210569)