Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Start position: 485709
End position: 485732
Length: 24

DNA sequence
>NC_011294, from 485709 to 485732 (24 bp); Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 GCGAAAGAGAAAGCGGAAGCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 484912-487266	Sequence	SEN0432 lon DNA-binding ATP-dependent protease La