Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 757568
End position: 757597
Length: 30

DNA sequence
>NC_011274, from 757568 to 757597 (30 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 CCAGCCCCAGCCCCAGCCCCAGCCCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 757432-760134	Sequence	SG0700 kdpD sensor protein KdpD (Protein is coded in complementary strand; from 760134 to 757432)