Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 3936783
End position: 3936806
Length: 24

DNA sequence
>NC_011274, from 3936783 to 3936806 (24 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 TTTCTTGTTCTTTTTGTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3936227-3936910	Sequence	SG3740 - lipoprotein (Protein is coded in complementary strand; from 3936910 to 3936227)