Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 3842077
End position: 3842103
Length: 27

DNA sequence
>NC_011274, from 3842077 to 3842103 (27 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 GCGCCCGGCGCGCCAGGCGCGCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3841331-3842713	Sequence	SG3653 - glycosyl hydrolase (Protein is coded in complementary strand; from 3842713 to 3841331)