Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 2336455
End position: 2336481
Length: 27

DNA sequence
>NC_011274, from 2336455 to 2336481 (27 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 GCAGCGCCAGCAGCACCAGCGGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2336355-2336567	Sequence	SG2279 ccmD2 heme exporter protein D2 (Protein is coded in complementary strand; from 2336567 to 2336355)