Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 2333076
End position: 2333102
Length: 27

DNA sequence
>NC_011274, from 2333076 to 2333102 (27 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 CGTCAGCGGGGTCAGCGGGGTCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2332348-2333400	Sequence	SG2275 - cytochrome c-type biogenesis protein H1 (Protein is coded in complementary strand; from 2333400 to 2332348)