Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Start position: 1200290
End position: 1200316
Length: 27

DNA sequence
>NC_011274, from 1200290 to 1200316 (27 bp); Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 AGCAGTGCCAGCACTGCCAGCACTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1200128-1201348	Sequence	SG1116 tyrP tyrosine-specific transport protein (Protein is coded in complementary strand; from 1201348 to 1200128)