Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 4323204
End position: 4323248
Length: 45

DNA sequence
>NC_011094, from 4323204 to 4323248 (45 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 GTCAGATTCTGACCCGTCAAAATCTGACGCATCAAAATCTGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4322903-4323844	Sequence	SeSA_A4446 - phage O protein family protein