Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 4206597
End position: 4206626
Length: 30

DNA sequence
>NC_011094, from 4206597 to 4206626 (30 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 CGCGGTAAATCTCGATAAATGGCGGTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4205486-4206637	Sequence	SeSA_A4330 argE acetylornithine deacetylase (Protein is coded in complementary strand; from 4206637 to 4205486)