Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 4178640
End position: 4178681
Length: 42

DNA sequence
>NC_011094, from 4178640 to 4178681 (42 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4178164-4179168	Sequence	SeSA_A4309 ftsN essential cell division protein FtsN (Protein is coded in complementary strand; from 4179168 to 4178164)