Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 3696746
End position: 3696769
Length: 24

DNA sequence
>NC_011094, from 3696746 to 3696769 (24 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3696306-3697208	Sequence	SeSA_A3826 dppC dipeptide transporter (Protein is coded in complementary strand; from 3697208 to 3696306)