Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 3369624
End position: 3369647
Length: 24

DNA sequence
>NC_011094, from 3369624 to 3369647 (24 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 TCGCTTTCGCTTTCTCTTCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3369350-3370522	Sequence	SeSA_A3493 obgE GTPase ObgE (Protein is coded in complementary strand; from 3370522 to 3369350)