Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 3128446
End position: 3128469
Length: 24

DNA sequence
>NC_011094, from 3128446 to 3128469 (24 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 CCGGCGCTGGCGCCGGTGCTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3128126-3129019	Sequence	SeSA_A3237 - chromosome replication initiation inhibitor protein