Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 2055585
End position: 2055614
Length: 30

DNA sequence
>NC_011094, from 2055585 to 2055614 (30 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 ATGGCGGTGGCGATGGCGGTGGCGGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2054736-2055938	Sequence	SeSA_A2155 - outer membrane protein F